c kit microbeads (Miltenyi Biotec)
Miltenyi Biotec is a verified supplier 
Miltenyi Biotec manufactures this product 
96
Structured Review
Miltenyi Biotec
c kit microbeads
C Kit Microbeads, supplied by Miltenyi Biotec, used in various techniques. Bioz Stars score: 96/100, based on 647 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/c+kit+cd117/CD117+MicroBeads%2C+mouse/bio_rxiv__64898__2026__03__26__714544-190-9-11
Average 96 stars, based on 647 article reviews
C Kit Microbeads, supplied by Miltenyi Biotec, used in various techniques. Bioz Stars score: 96/100, based on 647 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/c+kit+cd117/CD117+MicroBeads%2C+mouse/bio_rxiv__64898__2026__03__26__714544-190-9-11
Average 96 stars, based on 647 article reviews
c kit microbeads - by Bioz Stars,
2026-09
96/100 stars
Images
Related Articles
Magnetic Beads:Article Title: Bone marrow–derived fibroblasts are a functionally distinct stromal cell population in breast cancer Article Snippet: Data analysis was done with BD FACSDiva software (BD Biosciences). .. BM cells were harvested aseptically from femur, tibia and iliac bones of 6–8-wk old Col1α- DsRed female mice and enriched for Article Title: TP53 mutations and TET2 deficiency cooperate to drive leukemogenesis and establish an immunosuppressive environment Article Snippet: sgA20#1 (AACCATGCACCGATACACGC; crRNA), sgA20#2 (TCAACTGGTGTCGTGAAGTC;crRNA), and sgNeg (Negative Control crRNA #1, CAT#1072544) were synthesized from IDT (Integrated DNA Technologies, Inc.). .. Whole bone marrow cells were positively selected for other:Article Title: Genetic reporter analysis reveals an expandable reservoir of OCT4+ cells in adult skin Article Snippet: Rabbit anti-Oct4 sc-9081 (Santa Cruz), mouse anti-SMA-Cy3 C6198 (Sigma), rabbit anti-GFP SP3005P (Acris), rat anti-c-kit/CD117 clone Article Title: Erythropoietin preserves the endothelial differentiation capacity of cardiac progenitor cells and reduces heart failure during anticancer therapies. Article Snippet: Purity and marker profile of freshly isolated CPCs was determined by FACS analysis (FACS Calibur and LSRII, BD Biosciences) with antibodies against Sca-1, CD31, CD34, CD45, CD144, CD106, CD13, CD29, CD44, CD73, CD90 (BD PharMingen), CD4, CD105, c-kit (CD117), Expressing:Article Title: Acly Deficiency Enhances Myelopoiesis through Acetyl Coenzyme A and Metabolic-Epigenetic Cross-Talk. Article Snippet: Cells were counted and depleted of cells expressing https://doi.org/10.4049/immunohorizons.2200086 D ow nloaded from http://journals.aai.org/im m unohorizons/article-pdf/6/12/837/1583682/ih2200086.pdf by guest on 10 February 2024 CD5, CD45R (B220), CD11b, Gr-1 (Ly-6G/C), 7-4, and Ter119 using a MACS lineage cell depletion kit (Miltenyi Biotec, catalog no. 130-090-858) according to the manufacturer s protocol. .. Cells were then counted again and enriched for cells expressing Magnetic Cell Separation:Article Title: Acly Deficiency Enhances Myelopoiesis through Acetyl Coenzyme A and Metabolic-Epigenetic Cross-Talk. Article Snippet: Cells were counted and depleted of cells expressing https://doi.org/10.4049/immunohorizons.2200086 D ow nloaded from http://journals.aai.org/im m unohorizons/article-pdf/6/12/837/1583682/ih2200086.pdf by guest on 10 February 2024 CD5, CD45R (B220), CD11b, Gr-1 (Ly-6G/C), 7-4, and Ter119 using a MACS lineage cell depletion kit (Miltenyi Biotec, catalog no. 130-090-858) according to the manufacturer s protocol. .. Cells were then counted again and enriched for cells expressing Article Title: TP53 mutations and TET2 deficiency cooperate to drive leukemogenesis and establish an immunosuppressive environment Article Snippet: sgA20#1 (AACCATGCACCGATACACGC; crRNA), sgA20#2 (TCAACTGGTGTCGTGAAGTC;crRNA), and sgNeg (Negative Control crRNA #1, CAT#1072544) were synthesized from IDT (Integrated DNA Technologies, Inc.). .. Whole bone marrow cells were positively selected for |
